View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1136_low_7 (Length: 319)
Name: NF1136_low_7
Description: NF1136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1136_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 82 - 146
Target Start/End: Original strand, 27859844 - 27859908
Alignment:
| Q |
82 |
atatcaacacataaacataggaattttaacctcattacagttaccaacaaaaaactaagtgtgat |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27859844 |
atatcaacacataaacataggaattttaacctcattacagttaccaacaaaaaactaagtgtgat |
27859908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University