View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1136_low_8 (Length: 319)
Name: NF1136_low_8
Description: NF1136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1136_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 39 - 127
Target Start/End: Original strand, 32767351 - 32767439
Alignment:
| Q |
39 |
aacgatgtggtttggttgataagctaagagctgttgacggatgaaatgttgcgtttaatcacaaaaaactaatgtaactattaatattt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||| |||||||||||||||| |
|
|
| T |
32767351 |
aacgatgtggtttggttgataagctaagagctgttgactgatgaaatgttgcgtttaataaaaaaaaactaacgtaactattaatattt |
32767439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University