View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11370_high_6 (Length: 268)
Name: NF11370_high_6
Description: NF11370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11370_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 69 - 173
Target Start/End: Complemental strand, 48533752 - 48533648
Alignment:
| Q |
69 |
acaagtttactctagagttgccggatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgaggagtcggcggatctagagtg |
168 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48533752 |
acaagtttactctagagttgccagatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgaggagtcggcggatctagagtg |
48533653 |
T |
 |
| Q |
169 |
agtga |
173 |
Q |
| |
|
||||| |
|
|
| T |
48533652 |
agtga |
48533648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 46 - 150
Target Start/End: Complemental strand, 48536751 - 48536647
Alignment:
| Q |
46 |
gactatcaatattaaaattgaacacaagtttactctagagttgccggatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtc |
145 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||| |||||| || ||||| ||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
48536751 |
gactatcaatatcaaagttgaacacaagtttacggtagagttggcggatctggtgaccgttgtcgctgcagattcgacgaaagcgccgagcatcgatgtt |
48536652 |
T |
 |
| Q |
146 |
gagga |
150 |
Q |
| |
|
||||| |
|
|
| T |
48536651 |
gagga |
48536647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 48533613 - 48533570
Alignment:
| Q |
208 |
gatggatatgcatgctcttattgcttcttcttcatttcatttca |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48533613 |
gatggatatgcatgctcttattgcttcttcttcatttcatttca |
48533570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University