View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11370_high_6 (Length: 268)

Name: NF11370_high_6
Description: NF11370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11370_high_6
NF11370_high_6
[»] chr3 (3 HSPs)
chr3 (69-173)||(48533648-48533752)
chr3 (46-150)||(48536647-48536751)
chr3 (208-251)||(48533570-48533613)


Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 69 - 173
Target Start/End: Complemental strand, 48533752 - 48533648
Alignment:
69 acaagtttactctagagttgccggatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgaggagtcggcggatctagagtg 168  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48533752 acaagtttactctagagttgccagatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtcgaggagtcggcggatctagagtg 48533653  T
169 agtga 173  Q
    |||||    
48533652 agtga 48533648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 46 - 150
Target Start/End: Complemental strand, 48536751 - 48536647
Alignment:
46 gactatcaatattaaaattgaacacaagtttactctagagttgccggatccggcgaccgctgtcgctgcagattcgacggaagcgccgagcatcaatgtc 145  Q
    |||||||||||| ||| ||||||||||||||||  |||||||| |||||| || ||||| ||||||||||||||||||| |||||||||||||| ||||     
48536751 gactatcaatatcaaagttgaacacaagtttacggtagagttggcggatctggtgaccgttgtcgctgcagattcgacgaaagcgccgagcatcgatgtt 48536652  T
146 gagga 150  Q
    |||||    
48536651 gagga 48536647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 48533613 - 48533570
Alignment:
208 gatggatatgcatgctcttattgcttcttcttcatttcatttca 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
48533613 gatggatatgcatgctcttattgcttcttcttcatttcatttca 48533570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University