View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11371_high_4 (Length: 225)

Name: NF11371_high_4
Description: NF11371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11371_high_4
NF11371_high_4
[»] chr1 (2 HSPs)
chr1 (121-218)||(34580840-34580937)
chr1 (42-92)||(34580962-34581012)


Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 121 - 218
Target Start/End: Complemental strand, 34580937 - 34580840
Alignment:
121 tatcaatgcagttaataggaacaagtattataatataaatctacgtacaatattgaatgatagtaagtctagcggaatatccccgtgagttcatctca 218  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| ||||    
34580937 tatcaatgcagttaataggaacaagtattataatataaatctaggtacaatattgaatgatagtaagtctagcgaaatatccccgtgagttcagctca 34580840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 92
Target Start/End: Complemental strand, 34581012 - 34580962
Alignment:
42 aacacacacatatacgtgtcttaaatttttaagaaacaaaatcaggtatgg 92  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
34581012 aacacacacatatacgtgtcttaaatttttaagaaacaaaatcaggtatgg 34580962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University