View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11371_low_3 (Length: 390)
Name: NF11371_low_3
Description: NF11371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11371_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 1 - 374
Target Start/End: Complemental strand, 50767321 - 50766949
Alignment:
| Q |
1 |
gattcaagtggcgtggctttgaagaagttcaagaaagacagcgtttacattgataaaactggcaacttaaggaacttcaatcacaaaaaactttccagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50767321 |
gattcaagtggcgtggctttgaagaagttcaagaaagacagcgtttacattgataaaactggcaacttaaggaacttcaatcacaaaaaactttccagga |
50767222 |
T |
|
| Q |
101 |
aaaaatgtaaatctattctatactctcctacctgaaacacaacacaagttttgtatgtgtaaacagtgttgttattttctttgagtaggtggttctttga |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50767221 |
aaaaatgtaa-tctattctatactctcctacctgaaacacaacacaagttttgtatgtgtaaacagtgttgttattttctttgagtaggtggttctttga |
50767123 |
T |
|
| Q |
201 |
gaggaagaggatggaagtttggttctggatttgttgatgggattttcccagtgttgagtcccactgcactgcagattttggagtatcttcaaaaggaagt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50767122 |
gaggaagaggatggaagtttggttctggatttgttgatgggattttcccagtgttgagtcccactgcactgcagattttggagtatcttcaaaaggaagt |
50767023 |
T |
|
| Q |
301 |
ggattctgagagaatttggggttcactggataagcttccaccatctcttgatgcatgggatgatgttttaactg |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50767022 |
ggattctgagagaatttggggttcactggataagcttccaccatctcttgatgcatgggatgacgttttaactg |
50766949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University