View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11371_low_5 (Length: 225)
Name: NF11371_low_5
Description: NF11371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11371_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 121 - 218
Target Start/End: Complemental strand, 34580937 - 34580840
Alignment:
| Q |
121 |
tatcaatgcagttaataggaacaagtattataatataaatctacgtacaatattgaatgatagtaagtctagcggaatatccccgtgagttcatctca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
34580937 |
tatcaatgcagttaataggaacaagtattataatataaatctaggtacaatattgaatgatagtaagtctagcgaaatatccccgtgagttcagctca |
34580840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 92
Target Start/End: Complemental strand, 34581012 - 34580962
Alignment:
| Q |
42 |
aacacacacatatacgtgtcttaaatttttaagaaacaaaatcaggtatgg |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34581012 |
aacacacacatatacgtgtcttaaatttttaagaaacaaaatcaggtatgg |
34580962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University