View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11372_high_1 (Length: 427)
Name: NF11372_high_1
Description: NF11372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11372_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 83 - 306
Target Start/End: Complemental strand, 36932584 - 36932361
Alignment:
| Q |
83 |
gacattgtatgagaaaataagttcaaacatgaaagatcaggagattaactgttccatggctttgagccaaacgggctcggccttggccaaacccttcacg |
182 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36932584 |
gacattgtaagagaaaataagttcaaacatgaaagatcaggagattaactgttccatggctttgagccaaacgggctcggccttggccaaacccttgacg |
36932485 |
T |
|
| Q |
183 |
agctttctggaccgagaaagcaaatctcctttcataaacgacattgttcccacttctttgattttcgttctctgttgctagttgcttcaatgcgtctctt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36932484 |
agctttctggaccgagaaagcaaatctcctttcataaacgacattgttcccacttctttgattttcgttctctgttgctagttgcttcaatgcgcctctt |
36932385 |
T |
|
| Q |
283 |
gctgttgcaggcaacaaaacaaaa |
306 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36932384 |
gctgttgcaggcaacaaaacaaaa |
36932361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 350 - 394
Target Start/End: Complemental strand, 36932357 - 36932313
Alignment:
| Q |
350 |
cagtttcaatttcagttaaaaatcaaataacacagtttcagtttc |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36932357 |
cagtttcaatttcagttaaaaatcaaataacacagtttcaatttc |
36932313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 96; Significance: 6e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 128 - 239
Target Start/End: Complemental strand, 990422 - 990311
Alignment:
| Q |
128 |
taactgttccatggctttgagccaaacgggctcggccttggccaaacccttcacgagctttctggaccgagaaagcaaatctcctttcataaacgacatt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
990422 |
taactgttccatggctttgagccaaacaggttcggccatggccaaacccttgacgagctttctggaccgagaaagcaaatctcctttcataaacgacatt |
990323 |
T |
|
| Q |
228 |
gttcccacttct |
239 |
Q |
| |
|
|||||||||||| |
|
|
| T |
990322 |
gttcccacttct |
990311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University