View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11373_low_4 (Length: 249)
Name: NF11373_low_4
Description: NF11373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11373_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 34426060 - 34425823
Alignment:
| Q |
1 |
cccactcatatagttaagataggcatatccactgatctgaagaatttacctgttggaaagttcgggtcaaatgggaagaatgacagaagagttaaattga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34426060 |
cccactcatatagttaagataggcatatccactgatctgaagaatatacctgttggaaagttcgggtcaaatgggaagaatgacagaagagttaaattga |
34425961 |
T |
 |
| Q |
101 |
ttgagatatatccagctcgtcaggactcatcgtaagcccaaatgttatatgttaccattttcagctgctagtttatttcaatattttttagactt-aaag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34425960 |
ttgagatatatccagctcgtcaggactcatcgtaagcccaaatgttatatgttaccattttcagctgctagtttatttcaatattttttagacttaaaag |
34425861 |
T |
 |
| Q |
200 |
tattatagaataacagaatatccctacttgtttcccta |
237 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34425860 |
tattatagaataacaaaatatccctacttgtttcccta |
34425823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University