View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11374_high_23 (Length: 326)
Name: NF11374_high_23
Description: NF11374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11374_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 15 - 307
Target Start/End: Original strand, 12011902 - 12012194
Alignment:
| Q |
15 |
agaacaagctttgaggagaaaagggaaagtgtgtttaccagggatagcaccgtgtctacgcatttgaatgtaaagggagagagaaatgcggggttgttgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||| |||||| |
|
|
| T |
12011902 |
agaacaagctttgaggagaaaagggaaagtgtgtttaccagggataacaccgtgtctacgcatttgaatgtaaagggaaagagaaatgtggggctgttgt |
12012001 |
T |
 |
| Q |
115 |
tgttgatgagcgcggatgagagtgttccacatgaatgaattgggtttgtgtaaggaggagaagattctagaagcgtgttcgaggttaccgaaaggggaga |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12012002 |
tgttgatgcgcgcggatgagagtgttccacatgaatgaattgggtttgtgtaaggaggagaagattctagaagcgtgttcgaggttaccgaaaggggaaa |
12012101 |
T |
 |
| Q |
215 |
gagcaaaagaggagaataaacggcttgtggcgaattggtcgttgatgcgggatgtgatgatcatttgagcgtggatttgtttgaggtgttgta |
307 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12012102 |
gagcgaaagaggagaataaacggcttgtggcgaattggtcgttgatgcgggatgtgatgatcatttgagcgtggatttgtttgaggtgttgta |
12012194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University