View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11374_low_14 (Length: 424)
Name: NF11374_low_14
Description: NF11374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11374_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 374; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 21 - 414
Target Start/End: Original strand, 56457210 - 56457603
Alignment:
| Q |
21 |
tgtggcagcctgatcgattttagtgataacaccaactgttctggtggattctgaatcatattcctttgcaactctaagggatcgtgatgatgaaatttct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
56457210 |
tgtggcagcctgatcgattttagtgataacaccaactgttctggtggattctgaatcatattcctttgcaactctaagggctcgtgatgatgaaatttct |
56457309 |
T |
 |
| Q |
121 |
ggtgcctgagcggcaggaacaactacgagcaaaatagcgtcattgtgctcaagatattcagagatgattttgtcattgacaatacgctggtccagtccag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56457310 |
ggtgcctgagcggcaggaacaactacgagcaaaatagcgtcattgtgctcaagatattcagagatgattttgtcattgacaatacgctggtccagtccag |
56457409 |
T |
 |
| Q |
221 |
gcaaatcaatcaagttgaagggaggtgaagtagaagtacgaagtttgagatagatagggtcaggtttcttagtgccggatgaaactttgctgagtctatc |
320 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
56457410 |
gcaaatcaatcaagttgaagggaggtgcagtagaagtacgaagtttgagatagatagggtcaggtctcttagtgccggaagaaactttgctgagtctatc |
56457509 |
T |
 |
| Q |
321 |
ctgaagagaatgaagaagtgaagaagcagaaacttgttgggatttattattgatatgaaggaagatagaatttgaggttaaagatgcgtctctg |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
56457510 |
ctgaagagaatgaagaagtgaagaagcagaaacttgttgggatttattattgatatgaaggaagatagaatttgaggttaaagatgtgtctctg |
56457603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University