View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11374_low_22 (Length: 357)
Name: NF11374_low_22
Description: NF11374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11374_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 18 - 344
Target Start/End: Complemental strand, 48144594 - 48144268
Alignment:
| Q |
18 |
ttgataaattcacaaactttgctcaaaagggtacacgctaatcatctttaatttcgaagaagatgaatcaataacctaatcatgtgtggttaagcaagct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48144594 |
ttgataaattcacaaactttgctcaaaagggtacacgctaatcatctttaatttcgaagaagatgaatcaataacctaatcatgtgtggttaagcaagct |
48144495 |
T |
|
| Q |
118 |
taatccaaaaggaattgataacattgaaattgaaatgcgtgttgtgtaatgttaaacttggttggttgatttcaccaaacgttgtaaggtatggtatggc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48144494 |
taatccaaaaggaattgataacattgaaattgaaatgcgtgttgtgtaatgttaaacttggttggttgatttcaccaaacgttgtaaggtatggtatggc |
48144395 |
T |
|
| Q |
218 |
tgcggacaaggtaggaaatggaattcgttgtaatcttattctatttgactttgttttcttccattgacaaagatagttttgataactctcaattttttat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48144394 |
tgcggacaaggtaggaaatggaattcgttgtaatcttattctatttgactttgttttcttccattgacaaagatagttttgataactctcaattttttat |
48144295 |
T |
|
| Q |
318 |
ttcttctttatatatcatctttatctc |
344 |
Q |
| |
|
||||||||||||||| ||||||||||| |
|
|
| T |
48144294 |
ttcttctttatatattatctttatctc |
48144268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University