View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11374_low_35 (Length: 277)
Name: NF11374_low_35
Description: NF11374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11374_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 72 - 259
Target Start/End: Original strand, 49180320 - 49180507
Alignment:
| Q |
72 |
gaaaatgctgctagttgctattgaacgcggggaaggattcctgttaaattctttgtttaatgcagtgacttacaaaaatggctatatgccacgtataaga |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180320 |
gaaaatgctgctagttgctattgaacgcggggaaggattcctgttaaattctttgttcaatgcagtgacttacaaaaatggctatatgccacgtataaga |
49180419 |
T |
 |
| Q |
172 |
tgagtttgctgctacagggctggaagtcaggtttgagactgtgtctgtgttttgtttgatcttcctttcgttcactatgcatactatt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180420 |
tgagtttgctgctacagggctggaagtcaggtttgagactgtgtctgtgttttgtttgatcttcctttcgttcactatgcatactatt |
49180507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 49180171 - 49180247
Alignment:
| Q |
1 |
aggtgaaaatcactaaatttgtccttcacctattgcatggttgacaactacataattgttaacttttgtgggaaaat |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180171 |
aggtgaaaatcactaaatttgtccttcacctattgcatggttgacaactacataattgttaacttttgtgggaaaat |
49180247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University