View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11374_low_42 (Length: 242)
Name: NF11374_low_42
Description: NF11374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11374_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 5 - 223
Target Start/End: Complemental strand, 3598515 - 3598297
Alignment:
| Q |
5 |
agaagatttagagtaagtcttaatctattaacattacttaatgcagaataattgctgataattacgtgctttttatttgattaatttacacttcgtaggg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
3598515 |
agaagatttagagtaagtcttaatctattaacattactcaatgcagaataattgctgataattacatgctttttatttgattaatttacactttgtaggg |
3598416 |
T |
|
| Q |
105 |
gggaatagaattcattgcacattatcggatgactatgccgtgaaaatgcaaaagtttttggataatcatgattatcacttcctgtgattgttttgtaaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3598415 |
gggaatagaattcattgcacattatcggatgactatgccgtgaaaatgtaaaagtttttggataatcatgattatcacttcctgtgattgttttgtaaaa |
3598316 |
T |
|
| Q |
205 |
cttcaggtaaagttcctaa |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3598315 |
cttcaggtaaagttcctaa |
3598297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 5 - 221
Target Start/End: Original strand, 4356506 - 4356726
Alignment:
| Q |
5 |
agaagatttagagtaagtcttaatctattaacattacttaatgcagaataattgctgataattacgtgct----ttttatttgattaatttacacttcgt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||| ||||| ||||||||| ||||| ||| ||||||||||||| |||||||| |
|
|
| T |
4356506 |
agaagatttagagcaagtcttaatctattaacattactcaatgcagaacaattgttgataattatgtgctaacttttaatttgattaatttgcacttcgt |
4356605 |
T |
|
| Q |
101 |
aggggggaatagaattcattgcacattatcggatgactatgccgtgaaaatgcaaaagtttttggataatcatgatt-atcacttcctgtgattgttttg |
199 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| | |||| |||||||||||||| ||| |||||||||| |||| || |
|
|
| T |
4356606 |
agggg-gaatagaattcattgcacattatcggatgactatgccgtgagaatgcaacaattttaggataatcatgattcatcgcttcctgtgactgttctg |
4356704 |
T |
|
| Q |
200 |
taaaacttcaggtaaagttcct |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4356705 |
caaaacttcaggtaaagttcct |
4356726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University