View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11374_low_48 (Length: 223)
Name: NF11374_low_48
Description: NF11374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11374_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 9712467 - 9712255
Alignment:
| Q |
1 |
caaagactattgtgacaacacatcacacatttaaggtccaaaatgattgtttactccattgagaaattacatttttaaggagcatcaaaggttatgaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9712467 |
caaagactattgtgacaacacatcacacatgtaaggtccaaaatgattgtttactccattgagaaattacatttttaaggagcatcaaaggttatgaaca |
9712368 |
T |
 |
| Q |
101 |
tgtatctgcttggcaggtatattggagtttctactggtaatatttcagttttgaagcttgatcaaaatttgcatgtggtacggatgagttacactatacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9712367 |
tgtatctgcttggcaggtatattggagtttctactggtaatatttcagttttgaagcttgatcaaaatttgcatgtggtacggatgagttacactatacc |
9712268 |
T |
 |
| Q |
201 |
cctctctgcttct |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9712267 |
cctctctgcttct |
9712255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 138 - 205
Target Start/End: Complemental strand, 9724413 - 9724346
Alignment:
| Q |
138 |
taatatttcagttttgaagcttgatcaaaatttgcatgtggtacggatgagttacactatacccctct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| | ||| |||||| |||||||||| |
|
|
| T |
9724413 |
taatatttcagttttgaagcttgatcaaaatttgcacgtggtaaagttgaattacaccatacccctct |
9724346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 93 - 161
Target Start/End: Original strand, 31106371 - 31106440
Alignment:
| Q |
93 |
tatgaacatgtatctgc-ttggcaggtatattggagtttctactggtaatatttcagttttgaagcttga |
161 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||| ||||| ||||||||| ||||||||||||||||| |
|
|
| T |
31106371 |
tatgaacatgtatctgtgttgataggtatattggacattctaatggtaatatatcagttttgaagcttga |
31106440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University