View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11374_low_49 (Length: 204)
Name: NF11374_low_49
Description: NF11374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11374_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 12 - 188
Target Start/End: Original strand, 34934999 - 34935175
Alignment:
| Q |
12 |
agcatagggaggttcttgtttcagccgatggggctgttccggttgactcggaagattttccggctgaggtagggaatggcactacaattgctgggagtgc |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34934999 |
agcataaggaggttcttgtttcagccgatggggctgttccggttgactcggaagattttccggctgaggtagggaatggcactacaattgctgggagtgc |
34935098 |
T |
 |
| Q |
112 |
tatgatggatttgaagactgcaatttcaacagctaatgattggaatcaaatcgctgttaggattcagatgagtggga |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34935099 |
tatgatggatttgaagactgcaatttcaacagctaatgattggaatcaaatcgctgttaggattcagatgagtggga |
34935175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University