View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11374_low_49 (Length: 204)

Name: NF11374_low_49
Description: NF11374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11374_low_49
NF11374_low_49
[»] chr2 (1 HSPs)
chr2 (12-188)||(34934999-34935175)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 12 - 188
Target Start/End: Original strand, 34934999 - 34935175
Alignment:
12 agcatagggaggttcttgtttcagccgatggggctgttccggttgactcggaagattttccggctgaggtagggaatggcactacaattgctgggagtgc 111  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34934999 agcataaggaggttcttgtttcagccgatggggctgttccggttgactcggaagattttccggctgaggtagggaatggcactacaattgctgggagtgc 34935098  T
112 tatgatggatttgaagactgcaatttcaacagctaatgattggaatcaaatcgctgttaggattcagatgagtggga 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34935099 tatgatggatttgaagactgcaatttcaacagctaatgattggaatcaaatcgctgttaggattcagatgagtggga 34935175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University