View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_high_17 (Length: 418)
Name: NF11375_high_17
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-122; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 175 - 401
Target Start/End: Complemental strand, 8807689 - 8807463
Alignment:
| Q |
175 |
cctccaacaagtgcaaacaaaactagttgaaccacctatgcttccaaaaaattcatgcaatgaaacatgtggaaaactccatgttccatttccattctac |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807689 |
cctccaacaagtgcaaacaaaactagttgaaccacctttgcttccaaaaaattcatgcaatgaaacatgtggaaaactccatgttccatttccattctac |
8807590 |
T |
 |
| Q |
275 |
atcaacaacacttcatgtgcttcattgtcaagttctttccacctctcttgctcaaattcatccacccttttgatcaaaataggttcacaaaactatccca |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807589 |
atcaacaacacttcatgtgcttcattgtcaagttctttccacctctcttgctcaaattcatccacccttttgatcaaaataggttcacaaaactatccca |
8807490 |
T |
 |
| Q |
375 |
ttttggaattcttttcagatggtttgt |
401 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8807489 |
ttttggaattcttttcagatggtttgt |
8807463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 16 - 121
Target Start/End: Complemental strand, 8807848 - 8807743
Alignment:
| Q |
16 |
atgaacgcattgttttttctttaacacctaaactcaacaagttctttcactagcactgtcactgccactgctactagcaatgtttaatgttgttgtcctc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807848 |
atgaacgcattgttttttctttaacacctaaactcaacaagttctttcactagcactgtccctgccactgctactagcaatgtttaatgttgttgtcctc |
8807749 |
T |
 |
| Q |
116 |
atgaaa |
121 |
Q |
| |
|
|||||| |
|
|
| T |
8807748 |
atgaaa |
8807743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 401
Target Start/End: Complemental strand, 22923937 - 22923864
Alignment:
| Q |
328 |
aaattcatccacccttttgatcaaaataggttcacaaaactatcccattttggaattcttttcagatggtttgt |
401 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||| || ||| ||||||| | |||| |||||| |
|
|
| T |
22923937 |
aaattcatctacccttttgaacaaaataggttcacaaaactatcttatcttgaaattcttcttagattgtttgt |
22923864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University