View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_high_23 (Length: 388)
Name: NF11375_high_23
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 4669836 - 4670066
Alignment:
| Q |
1 |
atgccctatttgttggttgatttgctggattttttaacatattcaatcttttcctggccggttcatcatccataccatcttctggtacccctataacttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4669836 |
atgccctatttgttggttgatttgctggattttttaacatattcaatcttttcctggctggttcatcatccataccatcttttggtacccctataacttt |
4669935 |
T |
 |
| Q |
101 |
ttgtttctcttttgaaggagctcattctttcatcacatggttgtagcatccccaatgcatacaaattatgtgtagacccaccatgtattgcacttggtac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4669936 |
ttgtttctcttttgaaggagctcattctttcatcacatggttgtagcatccccaatgcatacaaattatatgtagacccaccatgtattgcacttggtac |
4670035 |
T |
 |
| Q |
201 |
cactgtccctttatccctacacgaccaacaa |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4670036 |
cactgtccctttatccctacacgaccaacaa |
4670066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 210 - 372
Target Start/End: Original strand, 4670688 - 4670859
Alignment:
| Q |
210 |
tttatccctacacgaccaacaatcgtctttgcaaggtaagcttccatgcacatacgcgcaaaccttcacaagcaacattcaaggtttgaagatcaac--- |
306 |
Q |
| |
|
|||| ||||||||||||||||||||||| || ||||||||||||||||||||| | ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4670688 |
tttaaccctacacgaccaacaatcgtctgtg--aggtaagcttccatgcacatatgtgcaaaccttcacaagcaaccttcaaggtttgaagatcaacttt |
4670785 |
T |
 |
| Q |
307 |
-------ttgccgaccattgagaccatagtccacaaaacacttttgtca-caaaaaacaaggtttaggttcata |
372 |
Q |
| |
|
||| ||||| ||||||| |||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4670786 |
aaaatggttgtcgacctttgagactgaagtccaaaaaacacttttgtcataaaaaaacaaggtttaggttcata |
4670859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 268 - 372
Target Start/End: Original strand, 4670064 - 4670160
Alignment:
| Q |
268 |
caaaccttcacaagcaacattcaaggtttgaagatcaacttgccgaccattgagaccatagtccacaaaacacttttgtcac-aaaaaacaaggtttagg |
366 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4670064 |
caaaccttcacaagccacattcaaggtttgaagatcaacttgcc---------gaccatagtccacaaaacacttttgtcacaaaaaaacaaggtttagg |
4670154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 104 - 239
Target Start/End: Original strand, 10872953 - 10873093
Alignment:
| Q |
104 |
tttctcttttgaaggagctcattctttcatcacatggttgtag--------catccccaatgcatacaaattatgtgtagacccaccatgtattgcactt |
195 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| |||| ||||| |||| |||||||||||||||||||||| | ||||||||||| |
|
|
| T |
10872953 |
tttctcttttgaaggagcacactctttcatcacatggtcgtagactcatagcatccacaatacatacaaattatgtgtagaccctc---gtattgcactt |
10873049 |
T |
 |
| Q |
196 |
ggtaccactgtccctttatccctacacgaccaacaatcgtcttt |
239 |
Q |
| |
|
||||| ||| ||| |||||||| |||| ||||||||| |||||| |
|
|
| T |
10873050 |
ggtactactctccatttatccccacacaaccaacaatagtcttt |
10873093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University