View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_high_41 (Length: 281)
Name: NF11375_high_41
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_high_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 277
Target Start/End: Complemental strand, 27866062 - 27865805
Alignment:
| Q |
20 |
aacagtccctgcagaacgaagaaatgcataagatgtaaatgattatttatgaaaagagtactatgatatccgtgtttgcccgtttgtcccaaatttgtgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27866062 |
aacagtccctgcagaacgaagaaatgcataagatgtaaatgagtatttatgaaaagagtactatgatatccgtgtttgcccgtttgtcccaaatttgtgc |
27865963 |
T |
 |
| Q |
120 |
gcgtatctgctaagcagataagctacatattttaagttagacgcggatatttacaaatatttatgaatgtcaattttttaatgaatttttgtaatgcaaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27865962 |
gcgtatctgctaagcagataagctacatattttaagttatacgcggatatttacaaatatatgtgaatgtcaattttttaatggatttttgtaatgcaaa |
27865863 |
T |
 |
| Q |
220 |
acnnnnnnnnnaattacttaaaatataacaacaaaagttcatcactttcatctcactc |
277 |
Q |
| |
|
|| ||||||||||||| |||||| ||||||||||||||||||| |||||| |
|
|
| T |
27865862 |
actttttttttaattacttaaaatttaacaataaaagttcatcactttcatttcactc |
27865805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University