View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_high_47 (Length: 252)
Name: NF11375_high_47
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_high_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 6473011 - 6472770
Alignment:
| Q |
1 |
gcagtgcaaagatggaggggagccctaacacaggtagccaatctctctggttgggatataaaggataagtaagtagtattttctatgtttgccgcaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6473011 |
gcagtgcaaagatggaggggagccctaacacaagtagccaatctctctggttgggatataaaggataagtaagtagtattttctatgtttgccgcaagtt |
6472912 |
T |
|
| Q |
101 |
g--atcaacacttttaagtttatactaacaaaatttcactgaacttttcaattaatttttggttcttgaattgttttatcaattaatctttgttatttat |
198 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6472911 |
gtgatcaacacttttaagtttatactaacaaaatttcaatgaacttttcaattaatttttggctcttgaattgttttatcaattaatctttgttatttat |
6472812 |
T |
|
| Q |
199 |
gttcgtggttttcaagtgataatttggaatttctattctctg |
240 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
6472811 |
gttcgtggttttcatgtgatgatttggaatttctattctctg |
6472770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 3 - 120
Target Start/End: Original strand, 13608639 - 13608756
Alignment:
| Q |
3 |
agtgcaaagatggaggggagccctaacacaggtagccaatctctctggttgggatataaaggataagtaagtagtattttctatgtttgccgcaagttga |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |||| ||| |
|
|
| T |
13608639 |
agtgcaaagatggaggggagccctaacacaagtagccaatctctctggttgggatatgaaggataagtaagtagtattttctctgtttgccacaagctga |
13608738 |
T |
|
| Q |
103 |
tcaacacttttaagttta |
120 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13608739 |
tcaacacttttaagttta |
13608756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 153 - 240
Target Start/End: Original strand, 13608867 - 13608954
Alignment:
| Q |
153 |
atttttggttcttgaattgttttatcaattaatctttgttatttatgttcgtggttttcaagtgataatttggaatttctattctctg |
240 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||| |||| |||||| ||| ||||| ||||||||||||||| ||||| |
|
|
| T |
13608867 |
atttttggttcttggattgttttatcaattaatctttgttgtttttgtttgtggttgtcatgtgatgatttggaatttctatcctctg |
13608954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 7e-24; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 3 - 122
Target Start/End: Original strand, 31244618 - 31244738
Alignment:
| Q |
3 |
agtgcaaagatggaggggagccctaacacaggtagccaatctctctggttgggatataaaggataagtaagtagtattttctatgtttgccgcaagttga |
102 |
Q |
| |
|
||||||||||||||| ||||||||| |||| |||||| | ||||||||||||||| ||| |||| |||||||||| |||||||||||||| ||||| || |
|
|
| T |
31244618 |
agtgcaaagatggagaggagccctagcacaagtagccgaactctctggttgggatgtaagggatcagtaagtagtcttttctatgtttgcaacaagtcga |
31244717 |
T |
|
| Q |
103 |
tcaacac-ttttaagtttata |
122 |
Q |
| |
|
||| || ||||||||||||| |
|
|
| T |
31244718 |
tcataactttttaagtttata |
31244738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 151 - 192
Target Start/End: Original strand, 31244823 - 31244864
Alignment:
| Q |
151 |
taatttttggttcttgaattgttttatcaattaatctttgtt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31244823 |
taatttttggttcttgaattgttttatcaattaatttttgtt |
31244864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 57
Target Start/End: Complemental strand, 31150889 - 31150836
Alignment:
| Q |
4 |
gtgcaaagatggaggggagccctaacacaggtagccaatctctctggttgggat |
57 |
Q |
| |
|
|||||||||||||||| ||| || ||||| || |||||||||||||| |||||| |
|
|
| T |
31150889 |
gtgcaaagatggagggaagcactgacacaagtggccaatctctctggatgggat |
31150836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 77
Target Start/End: Original strand, 31496522 - 31496595
Alignment:
| Q |
4 |
gtgcaaagatggaggggagccctaacacaggtagccaatctctctggttgggatataaaggataagtaagtagt |
77 |
Q |
| |
|
|||||||||||||||| ||| |||| ||| || || ||||||||||||||||| || | ||||||||| |||| |
|
|
| T |
31496522 |
gtgcaaagatggagggaagctctaatacaagtcgctgatctctctggttgggatctacatgataagtaaatagt |
31496595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 31159784 - 31159732
Alignment:
| Q |
7 |
caaagatggaggggagccctaacacaggtagccaatctctctggttgggatat |
59 |
Q |
| |
|
||||||||||||| | |||||||| || ||||||||||||||||||||||| |
|
|
| T |
31159784 |
caaagatggagggcaagtctaacacaagtcgccaatctctctggttgggatat |
31159732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 121
Target Start/End: Original strand, 14724137 - 14724251
Alignment:
| Q |
5 |
tgcaaagatggaggggagccctaacacaggtagccaatctctctggttgggatataaaggataagtaagtagtattttctatgtttgccgcaagttgatc |
104 |
Q |
| |
|
|||||| ||||||||||||| || |||| |||||||||| || || ||| ||||||||||| ||||||| |||||||||||||| || |||| | ||| |
|
|
| T |
14724137 |
tgcaaatatggaggggagccttagcacaagtagccaatccct--ggctggaatataaaggatcagtaagttgtattttctatgttagcaacaagataatc |
14724234 |
T |
|
| Q |
105 |
aacacttttaagtttat |
121 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
14724235 |
aacgcttttaagtttat |
14724251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 121
Target Start/End: Complemental strand, 17599713 - 17599599
Alignment:
| Q |
5 |
tgcaaagatggaggggagccctaacacaggtagccaatctctctggttgggatataaaggataagtaagtagtattttctatgtttgccgcaagttgatc |
104 |
Q |
| |
|
|||||| ||||||||| ||| |||| || |||||||||| || || ||| ||||||||||| ||||||| |||||||||||||| || |||| | ||| |
|
|
| T |
17599713 |
tgcaaatatggaggggtgccttaactcaagtagccaatccct--ggctggaatataaaggatcagtaagttgtattttctatgttagcaacaagataatc |
17599616 |
T |
|
| Q |
105 |
aacacttttaagtttat |
121 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
17599615 |
aacacttttaagtttat |
17599599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University