View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_high_49 (Length: 250)
Name: NF11375_high_49
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_high_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 40850980 - 40851221
Alignment:
| Q |
1 |
aaaatgcctgtcattgtgaaatttagagaatcttatatgtatgcacaacattagagtttaacatagaatttgcaattcatatttgtaggtaatgtgaaa- |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| | | || || |||||||||| |
|
|
| T |
40850980 |
aaaatgcctgtcattgtgaaatttagagaatcttat--gtatgcacaacattagagtttaacataaaatttgcaatttagagtt-tatgtaatgtgaatc |
40851076 |
T |
 |
| Q |
100 |
----ttaaccacttaatacaagtgaataattcaataaataaagtaatcttttcaaatgctattgtgatattattttctttaatcacttaacagatcaagt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40851077 |
aagtttaaccacttaatacaagtgaataattcaataaataaagtaatcatttcaaatattattgtgatattattttctttattcacttaacagatcaagt |
40851176 |
T |
 |
| Q |
196 |
tacctgcaagaaatcatatagatcattgctgacaccgtcttcatc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40851177 |
tacctgcaagaaatcatatagatcattgctaacaccgtcttcatc |
40851221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 146 - 240
Target Start/End: Original strand, 40840686 - 40840778
Alignment:
| Q |
146 |
ttcaaatgctattgtgatattattttctttaatcacttaacagatcaagttacctgcaagaaatcatatagatcattgctgacaccgtcttcatc |
240 |
Q |
| |
|
|||| ||| |||| ||||||||| |||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
40840686 |
ttcatatgttattttgatattatattctttaatcacttaacaaatcaagttacctgcaagaaa--atatagatcattgctaacaccgtcttcatc |
40840778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University