View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_high_59 (Length: 240)
Name: NF11375_high_59
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_high_59 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 23 - 225
Target Start/End: Original strand, 2206500 - 2206707
Alignment:
| Q |
23 |
tgcttaaggttctctgatattggtaaactccagatccacttccaacaaataattggcatgatctattgattggacaagcaatcaag-----tgtagccct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2206500 |
tgcttaaggttctctgatattggtaaactccaaatccacttccaacaaataattggcatgatctattgattggacaagcaatcaagccacatgtagccct |
2206599 |
T |
|
| Q |
118 |
gaatgactgagtaaatactattatggtaacttctccaaataagcttatcatcgatatcatggcaaatatttatattgtgaatgtaatcttgatagaaagg |
217 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2206600 |
gaatgactgagtaaatgctattatggtaacttctccaaataagcttatcatcgatatcatggccaatgtttatattgtgaatgtaatcttgatagaaagg |
2206699 |
T |
|
| Q |
218 |
atggagtt |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
2206700 |
atggagtt |
2206707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University