View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_high_70 (Length: 215)
Name: NF11375_high_70
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_high_70 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 51 - 155
Target Start/End: Complemental strand, 44546115 - 44546011
Alignment:
| Q |
51 |
gtataggtgatacctgtaacctgtgttgcattgcgtcatgcgtgtgatgttggagaaacgcagatgtgacaagagataagctgagcaaagtatttctact |
150 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44546115 |
gtataggtgaaacctgtaacctgtgttgcattgcgtcatgcgtgtgatgttggagaaacgcagatgtgacaagagataagcttagcaaagtatttctact |
44546016 |
T |
 |
| Q |
151 |
tttag |
155 |
Q |
| |
|
||||| |
|
|
| T |
44546015 |
tttag |
44546011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 152 - 195
Target Start/End: Complemental strand, 44545197 - 44545154
Alignment:
| Q |
152 |
ttagatcctaaataaaccaaactacagacgatacttgtctggtc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44545197 |
ttagatcctaaataaaccaaactacagacgatacttgtcaggtc |
44545154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University