View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_high_71 (Length: 213)
Name: NF11375_high_71
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_high_71 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 21050392 - 21050212
Alignment:
| Q |
19 |
agaacaccgatcgacaatcacaaagaaatcaacaaaccactgttcaaataagtgcnnnnnnncataagcgatggcattgcagtggatgatactcacctat |
118 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21050392 |
agaacaccgatcgataatcacgaagaaatcaacaaaccactgttcaaataagtgctttttttcataagcgatggcattgcagtggatgatactcacctat |
21050293 |
T |
|
| Q |
119 |
gtggtggctattgaagctgctgtagcaattcttctaacccttccttcaccaaagcttttgaggaaccgtttgacttctctg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21050292 |
gtggtggctattgaagctgctgtagcaattcttctaacccttccttcaccaaagcttttgaggaaccgtttgacttctctg |
21050212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 82 - 199
Target Start/End: Original strand, 26369810 - 26369927
Alignment:
| Q |
82 |
ataagcgatggcattgcagtggatgatactcacctatgtggtggctattgaagctgctgtagcaattcttctaacccttccttcaccaaagcttttgagg |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26369810 |
ataagcgatggcattgcagtggatgatactcacctatgtggtggctattgaagctgctgtagcgattcttctaacacttccttcaccaaagcttttgagg |
26369909 |
T |
|
| Q |
182 |
aaccgtttgacttctctg |
199 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
26369910 |
aaccgtttgacttctctg |
26369927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 26369762 - 26369814
Alignment:
| Q |
19 |
agaacaccgatcgacaatcacaaag-aaatcaacaaaccactgttcaaataag |
70 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
26369762 |
agaacaccgatcgataatcacaaagaaaatcaacaaaccaccgttcaaataag |
26369814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University