View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_low_29 (Length: 372)
Name: NF11375_low_29
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_low_29 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 20 - 372
Target Start/End: Original strand, 4860924 - 4861276
Alignment:
| Q |
20 |
tagtgtacggttaaataagtactctcttgttcaacttgaaaacattaggtttatgagtcatctcatttattaatgtccagctttcacttttccatacaat |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
4860924 |
tagtgtacggttaaataagtactcccttgttcaatttcaaaacattaggtttatgagtcatctcacttattaatatccagctttcacttttccatacaat |
4861023 |
T |
 |
| Q |
120 |
atgtaactattattcacatttgatatagcaacaatcatccccttatcattcattctttatgggtaagttcacccgtgtcaaacgaaacattttcatctat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
4861024 |
atgtaactattattcacatttgatatagcaacaatcatccccttatcattcattctttatgggtaagttcacccgcgtcaaacgaaactttttcatctat |
4861123 |
T |
 |
| Q |
220 |
ttctacttgcactatcattagtggcaatcttcaagacacactgcctgaacctccttgtctaaaagactttagatacaatgagttggttcaaccatcgact |
319 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
4861124 |
ttctacttgcaccatcattagtggcaatcttcaagacacactgcctgaacatccttgtctaaaagactttagatacaatgaactggttcaaccatcaact |
4861223 |
T |
 |
| Q |
320 |
ttaatatcacggtttgtttatgagggatccgaagaatcatcatatcaaatttt |
372 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
4861224 |
ttaatatcacagtttgttcatgagggatccgaagaatcatcatatcagatttt |
4861276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University