View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_low_43 (Length: 269)
Name: NF11375_low_43
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 15 - 181
Target Start/End: Complemental strand, 12008804 - 12008638
Alignment:
| Q |
15 |
atctcatctttgaaaacttgattttacaatatgaaatgcgacagatcataaacttcgacctaacattttactattgcataatttcaaccaaaattaaact |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12008804 |
atctcatctttgaaaacttgattttacaatatgaaatgcgacagatcctaaactttgacctaacattttactattgcataatttcaaccaaaattaaact |
12008705 |
T |
 |
| Q |
115 |
tattccaccataattctctatatttgctaatcaatctttgaacattaaattgctattcttcatattg |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
12008704 |
tattccaccataattctctatatttgctaatcaatctttgaaaattaaattgctattctgcatattg |
12008638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 243
Target Start/End: Complemental strand, 11984852 - 11984810
Alignment:
| Q |
201 |
tttgaataatgatatgataagtgtgatttggtaaaaatattct |
243 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11984852 |
tttgattaatgatatgataagtgtgaattggtaaaaatattct |
11984810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University