View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_low_50 (Length: 250)
Name: NF11375_low_50
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_low_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 6 - 137
Target Start/End: Complemental strand, 34436577 - 34436446
Alignment:
| Q |
6 |
atttcaggtacaaccttgacaacaccatggatggtttttacattgcacctgcttttatggacaagcttgttgtacacatcaccaagaacttcttgactct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34436577 |
atttcaggtacaaccttgacaacaccatggatggtttttacattgcacctgcttttatggacaagcttgttgtacacatcactaagaacttcttgactct |
34436478 |
T |
 |
| Q |
106 |
gcctaatatcaaggtatgtaatttgaatttga |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34436477 |
gcctaatatcaaggtatgtaatttgaatttga |
34436446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 204 - 243
Target Start/End: Original strand, 34435801 - 34435840
Alignment:
| Q |
204 |
gtagttatgtgtcagcttgtgtctggtgcgtgtgtctgtg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34435801 |
gtagttatgtgtcagcttgtgtctggtgcgtgtgtctgtg |
34435840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 11 - 126
Target Start/End: Complemental strand, 30666761 - 30666646
Alignment:
| Q |
11 |
aggtacaaccttgacaacaccatggatggtttttacattgcacctgcttttatggacaagcttgttgtacacatcaccaagaacttcttgactctgccta |
110 |
Q |
| |
|
||||||||| |||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| || || | |
|
|
| T |
30666761 |
aggtacaactttgacaacactatggatggattttacattgctcctgcttttatggacaagcttgttgttcacatcaccaagaatttcttgaccctaccaa |
30666662 |
T |
 |
| Q |
111 |
atatcaaggtatgtaa |
126 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
30666661 |
acatcaaggtatgtaa |
30666646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 6854228 - 6854140
Alignment:
| Q |
8 |
ttcaggtacaaccttgacaacaccatggatggtttttacattgcacctgcttttatggacaagcttgttgtacacatcaccaagaactt |
96 |
Q |
| |
|
||||||||||| | |||||||| | ||||| || || ||||||||||| |||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
6854228 |
ttcaggtacaatatggacaacacagttgatggcttgtatattgcacctgcatttatggacaagcttgttgttcacatcactaagaactt |
6854140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University