View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_low_51 (Length: 250)
Name: NF11375_low_51
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_low_51 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 36272841 - 36273073
Alignment:
| Q |
18 |
ttaacaaagtcagtttcatacatcaaaggaatattattagatgctgaactaaagcagatgcatggatattctgaccataagttgtataattggctatggc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36272841 |
ttaacaaagtcagtttcatacatcaaaggaatattattagatgctgaactaaagcagatgcatggatattctgaccataagttgtataattggctatggc |
36272940 |
T |
|
| Q |
118 |
ggatcagacgtgtcttttctgatgctgaaaaccttctggatgaagttgagctggaaaacttacaaaagaaagtaatcaaagtgcgtcgcagctgcagcaa |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36272941 |
ggatcagacatgtcttttctgatgctgaaaaccttctggatgaagttgagctggaaaacttacaaaagaaagtaatcaaagtgtgtcgcagctgcagcaa |
36273040 |
T |
|
| Q |
218 |
tacgatcataaccaaggtaaaccacttcttctc |
250 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |
|
|
| T |
36273041 |
tatgatcataaccaaggtaaaccacttcttctc |
36273073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University