View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_low_52 (Length: 249)
Name: NF11375_low_52
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_low_52 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 9 - 249
Target Start/End: Complemental strand, 55171863 - 55171621
Alignment:
| Q |
9 |
agcataggtacgccggacccaagtccatatccatccttggtctcaataaaggaaaacttgaactcactaagaacggttggggtcatcgggtaataatcaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171863 |
agcataggtacgccggacccaagtccatatccatccttggtctcaataaaggaaaacttgaactcactaagaacggttggggtcatcgggtaataatcaa |
55171764 |
T |
|
| Q |
109 |
t--atgccatccattgttactatatattcaagtgaaggcaatgagagactataattcaatttaatttgcaggttggtctcagaggtgagcaacttaaagt |
206 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171763 |
tttatgccatccattgttactatatattcaagtgaaggcaatgagagactataattcaatttaatttgcaggttggtctcagaggtgagcaacttaaagt |
55171664 |
T |
|
| Q |
207 |
tttcaccgaggaaggatcaaagaaggttcaatgggatccagtc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171663 |
tttcaccgaggaaggatcaaagaaggttcaatgggatccagtc |
55171621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University