View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_low_60 (Length: 240)
Name: NF11375_low_60
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_low_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 231
Target Start/End: Complemental strand, 46619209 - 46618994
Alignment:
| Q |
17 |
aagattatacatcaaatctatcacgctggcatagctggctccaatagctaaagacaattacagttacttcttttcttggctacaatttatatctatatcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46619209 |
aagattatacatcaaatctatcacgctggcatagctggctccaatagctaaagacaattacagttacttcttttcttggctacaatttatatctatatcc |
46619110 |
T |
 |
| Q |
117 |
attcaaactcaccacagcataaaccagaactttctacatttttggataaattggaaaaatttgtattgggtactgcatgtcgtgtgcgaac-aataagtt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| || |
|
|
| T |
46619109 |
attcaaactcaccacagcataaaccagaactttctacatttttggataaattggaaaaatttgtattgggtactgcatgtcatgtgcgaacaaataaatt |
46619010 |
T |
 |
| Q |
216 |
ttaggttcgatttacc |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46619009 |
ttaggttcgatttacc |
46618994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University