View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_low_65 (Length: 236)
Name: NF11375_low_65
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_low_65 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 70 - 224
Target Start/End: Original strand, 25494192 - 25494346
Alignment:
| Q |
70 |
gtctcttttctttaaaattaaaagattaagacaaaaaatgacaatttttgggaattctaacattttttgttgtgaatattcaggttcagtgtagattttg |
169 |
Q |
| |
|
||||||||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25494192 |
gtctcttttctctaaaactaaaggattaagacaaaaaatgacaatttttgggaattctaacattttttgttatgaatattcaggttcagtgtagattttg |
25494291 |
T |
|
| Q |
170 |
gcaagaatgaggtagaggttatgaagcatgtgtcaatctacttagattcatctca |
224 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25494292 |
gcaagaatgaggtagaagttatgaagcatgtgtcaatctacttagattcatctca |
25494346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 149 - 224
Target Start/End: Complemental strand, 28225970 - 28225895
Alignment:
| Q |
149 |
tcaggttcagtgtagattttggcaagaatgaggtagaggttatgaagcatgtgtcaatctacttagattcatctca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28225970 |
tcaggttcagtgtagattttggcaagaatgaggtagaggttatgaagcatgtgtcaatctacttagattcatctca |
28225895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University