View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_low_66 (Length: 231)
Name: NF11375_low_66
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_low_66 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 7 - 231
Target Start/End: Original strand, 4691359 - 4691581
Alignment:
| Q |
7 |
aaaatttatcaatttttactggttttgatttgtttggtagtgannnnnnnnnnncatcaataagaataagtcttgtgaaatacttaatcaaaatagaaaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4691359 |
aaaatttatcaatttttactggttttgatttgtttggtagtgattttttttt--catcaataagaataactcttgtgaaatacttaatcaaaatagaaaa |
4691456 |
T |
 |
| Q |
107 |
atataattaagatggtttatgtcatattgaaagaaacttaacctactgccagctgtgataaaataaaaaagttacgaaaatcaaaccaacactacttttg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4691457 |
atataattaagatggtttatgtcatattgaaagaaacttaacctactgccagctgtgataaaataaaaaagttacaaaaatcaaaccaacactacttttg |
4691556 |
T |
 |
| Q |
207 |
gttgtatacttaaacaatatcataa |
231 |
Q |
| |
|
| ||||| |||||||||||| |||| |
|
|
| T |
4691557 |
gatgtatgcttaaacaatatgataa |
4691581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University