View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11375_low_73 (Length: 210)
Name: NF11375_low_73
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11375_low_73 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 20 - 193
Target Start/End: Original strand, 13073187 - 13073360
Alignment:
| Q |
20 |
ccaaatacggtattcaacacttcttcgatcgccacacaactcaacaacaaaactctcagaaacttcaatccaccgattcaaatgcaacatctcaagttgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
13073187 |
ccaaatacggtattcaacacttcttcgatcgccacacaactcaacaacaaaactctcagaaacttcaatccaacaattcaaatgcaacatctcaagttgc |
13073286 |
T |
|
| Q |
120 |
tgatgctgcttccgattctcgaccaccgccggaaaaatccaccgatgctgttaatgaggctgatacgttatctg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13073287 |
tgatgctgcttccgattctcgaccaccgccggaaaaatctaccgatgctgttaatgaggctgatacgttatctg |
13073360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University