View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11377_low_6 (Length: 251)
Name: NF11377_low_6
Description: NF11377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11377_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 4244848 - 4244992
Alignment:
| Q |
1 |
gctaaatattggaagataaacactatgggttttgaatattgatggtgcaacaaactagcatatattatataatgttaatttacgcgctaacttataaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4244848 |
gctaaatattggaagataaacactatgggttttgaatattgatggtgcaacaaactagcatattatatataatgttaatttacgcgctaacttataaatg |
4244947 |
T |
 |
| Q |
101 |
cagtatatattccttaacatgcaagattcaatttcttgatgaggatt |
147 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4244948 |
cag--tatattccttaacatgcaagattcaatttcttgataaggatt |
4244992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University