View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11378_low_13 (Length: 250)
Name: NF11378_low_13
Description: NF11378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11378_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 38359888 - 38359660
Alignment:
| Q |
18 |
attactcacttgatttctcaaaaataagagaaacaaggaaacagaacaaaacaaatatttcaagagcaagtcttggcaatgatgaagagttcaatatgga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38359888 |
attactcacttgatttctcaaaaataagagaaacaaggaaacagaacaaaacaaatatttcaagagcaagtcttggcaatgatgaagagttcaatattga |
38359789 |
T |
 |
| Q |
118 |
ttcaacctccagcagtactactaacactgtcagcagcattgaacaacaac------aacacacccctcgct---atcatcaaacacactctccaactgta |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38359788 |
ttcaacctccagcagtacttctaacactgtcagcagcattgaacaacaacaacaacaacacacccctcgctatcatcatcaaacacactctccaactgta |
38359689 |
T |
 |
| Q |
209 |
agaatactaatttcatgcatatcagattc |
237 |
Q |
| |
|
||||||||||||| ||||||||||||||| |
|
|
| T |
38359688 |
agaatactaatttgatgcatatcagattc |
38359660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 108
Target Start/End: Complemental strand, 43351194 - 43351142
Alignment:
| Q |
56 |
aaacagaacaaaacaaatatttcaagagcaagtcttggcaatgatgaagagtt |
108 |
Q |
| |
|
||||||||||| || ||| |||||||||||||||||||||||| || ||||| |
|
|
| T |
43351194 |
aaacagaacaagaccaatgcttcaagagcaagtcttggcaatgaggaggagtt |
43351142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University