View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11378_low_5 (Length: 353)
Name: NF11378_low_5
Description: NF11378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11378_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 18 - 341
Target Start/End: Original strand, 52379412 - 52379734
Alignment:
| Q |
18 |
attagcacttgtcatgaaaacttaaccaacattatgcactgcatggattttttaagatgatggctttagaatgaaattgattgcataattacctttgctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52379412 |
attagcacttgtcatgaaaacttaaccaacattatgtactgcatggatttt-taagatgatagctttacaatgaaattgattgcataattacctttgctc |
52379510 |
T |
 |
| Q |
118 |
attgccaaattgccttccattggtgatattgataccagcacctcccctgtatgttggcagtgggatttgatcatgctcaattcgtatgagatcttccttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52379511 |
attgccaaattgccttccattggtgatattgataccagcacctcccctgtatgttggcagtgggatttgatcatgctcaattcgtatgagatcttccttg |
52379610 |
T |
 |
| Q |
218 |
aggatctcgtaatgcattttcacctcttgtatggattttccaccaacagcattagctacatgttgccaccgatttggatcttctggaccatatactgcaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52379611 |
aggatctcgtaatgcattttcacctcttgtatggattttccaccaacagcattagctacatgttgccaccgatttggatcttctggaccatatactgcaa |
52379710 |
T |
 |
| Q |
318 |
gtgcatcctcaaaacgtctgttct |
341 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52379711 |
gtgcatcctcaaaacgtctgttct |
52379734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University