View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11379_high_24 (Length: 444)
Name: NF11379_high_24
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11379_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 3e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 267 - 440
Target Start/End: Original strand, 2078287 - 2078460
Alignment:
| Q |
267 |
atgattctgagtctgaatttgaatcctctgcaatgcaattgcatctcattcatcaccagaagattcctatccagtgtggtccccacacattccccttcag |
366 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2078287 |
atgattctgagtctgaatttgaatcctctccaatgcaattgcatctcattcatcaccagaagattcctatccagtgtggtccccacacattccccttcag |
2078386 |
T |
|
| Q |
367 |
accatataaaaaccttagtttcaaagggtctttatcaccaaacacttcaatttttcacacaacttcatctctct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2078387 |
accatataaaaaccttagtttcaatgggtctttatcaccaaacacttcaatttttcacacaacttcatttctct |
2078460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 141; E-Value: 9e-74
Query Start/End: Original strand, 18 - 158
Target Start/End: Original strand, 2078039 - 2078179
Alignment:
| Q |
18 |
aaattgataatggaagttgagcttttaatcctggtattaattgatggtctggtaaacttgattgatgaaacatgtgaaccatcacttcaaatagaagaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2078039 |
aaattgataatggaagttgagcttttaatcctggtattaattgatggtctggtaaacttgattgatgaaacatgtgaaccatcacttcaaatagaagaag |
2078138 |
T |
|
| Q |
118 |
catcaattgtacatgttggagtcatattttttgaattattt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2078139 |
catcaattgtacatgttggagtcatattttttgaattattt |
2078179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University