View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11379_high_41 (Length: 367)

Name: NF11379_high_41
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11379_high_41
NF11379_high_41
[»] chr3 (1 HSPs)
chr3 (15-346)||(47366960-47367291)


Alignment Details
Target: chr3 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 15 - 346
Target Start/End: Complemental strand, 47367291 - 47366960
Alignment:
15 gcagcacagatagtttgattcctagcaaagtttcaggaaaaatagtgatatgtgaccgaggaggaaatcctagagctgaaaagagtttggtggtcaaacg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47367291 gcagcacagatagtttgattcctagcaaagtttcaggaaaaatagtgatatgtgaccgaggaggaaatcctagagctgaaaagagtttggtggtcaaacg 47367192  T
115 cgcaggaggaattgggatgattttagcaaacaaccaagattatggtgaagagctagttgctgactcctttctcctccctgcagcagctttgggagagaaa 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47367191 cgcaggaggaattgggatgattttagcaaacaaccaagattatggtgaagagctagttgctgactcctttctcctccctgcagcagctttgggagagaaa 47367092  T
215 gcaagcaatgaaataaagaagtatgcttcttcagctcccaatccaactgctaaaattgcatttggcggtacccggttcggggttcaaccatccccagtgg 314  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47367091 gcaagcaatgaaataaagaagtatgcttcttcagctcccaatccaactgctaaaattgcatttggcggtacccggttcggggttcaaccatccccagtgg 47366992  T
315 tggcagctttcagctctagaggaccaaatata 346  Q
    ||||||||||||||||||||||||||||||||    
47366991 tggcagctttcagctctagaggaccaaatata 47366960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University