View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11379_high_58 (Length: 318)
Name: NF11379_high_58
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11379_high_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 57 - 293
Target Start/End: Complemental strand, 43141217 - 43140982
Alignment:
| Q |
57 |
gatataatattgaaaggctttatttatttcacctttctcnnnnnnnacactctcttttactacaaacaaattaacacaagaatgtaacaccaataaaata |
156 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43141217 |
gatataatattgaaacactttatttatttcacctttctctttttttacactctcttttactacaaacaaattaacacaagaatgtaacaccaataaa-ta |
43141119 |
T |
 |
| Q |
157 |
ataacaccgcaacaaaaatgaacacaagagcgaaacaaaaactccttattccttcttcttcaccactttctctctatctatctatcttgacattgccatt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43141118 |
ataacaccgcaacaaaaatgaacacaagagcgaaacaaaaactcctcattccttcttcttcaccactttctctctatctatctatctcgacattgccatt |
43141019 |
T |
 |
| Q |
257 |
ctttgaactgattgtgttgctgttccgacaatgaaac |
293 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43141018 |
ctctgaactgattgtgttgctgttccgacaatgaaac |
43140982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University