View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11379_high_60 (Length: 306)
Name: NF11379_high_60
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11379_high_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 299
Target Start/End: Complemental strand, 39539663 - 39539365
Alignment:
| Q |
1 |
taaatgaataaataaatattagaacaacacataagtaaaaagagatattgcagctagctctactgtagtttgcaatgcatctgtataatgcagagataga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39539663 |
taaatgaataaataaatattagaacaacacacaagtaaaaagagatattgcagctagctctactgtagtttgcaatgcatctgtataatgcagagataga |
39539564 |
T |
 |
| Q |
101 |
taagagtgtcaatattttgaaatctttttggggtgatttatcagatgatactcaggccagggctcactgttcatatgttggcacaaacactcaagctgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39539563 |
taagagtgtcaatattttgaaatcattttggggtgatttatcagatgatactcaggccagggctcactgttcatatgttggcacaaacactcaagctgaa |
39539464 |
T |
 |
| Q |
201 |
ttggggcccaagaaacacaaaaaacaggcacttccacataatccagctccaaacatttcctcggaagcttttgttgagcctatcactagttctctgctc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39539463 |
ttggggcccaagaaacacaaaaaacaggcacttccacataatccagctccaaacatttcctcggaagcttttgttgagcctatcactagttctctgctc |
39539365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University