View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11379_high_62 (Length: 294)
Name: NF11379_high_62
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11379_high_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 263
Target Start/End: Complemental strand, 42563483 - 42563227
Alignment:
| Q |
20 |
atcagatcaatgttttgcaacttccaattcattttaactatgaagccatgtattgaggtattgtgtattatatgtaacagt-------------tgatga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42563483 |
atcagatcaatgttttgcaacttccaattcattttaactatgaagccatgtattgaggtattgtgtattatatgtaacagtatatgctatcagttgatga |
42563384 |
T |
|
| Q |
107 |
tttctatgatcacttttgattctgaatgtggaaaatctaagtgacgatgaaaaacaaggctcttactatagtgcatatttcttggtatgtattcatcttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42563383 |
tttctatgatcacttttgattctgaatgtggaaaatctaagtgacgatgaaaaacaaggctcttactatagtgcatatttcttggtatgtattcatcttc |
42563284 |
T |
|
| Q |
207 |
aagtggaattaattttttgcatagctccttttgttattgaacaaaattgaagaacac |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42563283 |
aagtggaattaattttttgcatagctccttttgttattgaacaaaattgaacaacac |
42563227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University