View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11379_high_67 (Length: 281)
Name: NF11379_high_67
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11379_high_67 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 58 - 250
Target Start/End: Complemental strand, 16060039 - 16059846
Alignment:
| Q |
58 |
atgggatcggagaattgattaaataaataaagaaatggaaaaa-gaacctgcagctgcggcgaggccacggcggtggatgagttgaatgggagatttgga |
156 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16060039 |
atgggatcggagaattgattaagtaaatagagaaatggaaaaaagaacctgcagctgcggcgaggccacggcggtggatgagttgaatgggagatttgga |
16059940 |
T |
|
| Q |
157 |
agaggaagcggcgatgcgagttagagatgcggctccgcgtacgagagaggccatgattgctttcgaacttcagagaaatgggcagacagtgttg |
250 |
Q |
| |
|
||||| || | |||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||| |
|
|
| T |
16059939 |
agagggggcagtgatgcgagttagagatgcggctccgcgtacgagagaggccatgatttctatcgagcttcagagaaatgggcagacagtgttg |
16059846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University