View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11379_high_68 (Length: 265)

Name: NF11379_high_68
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11379_high_68
NF11379_high_68
[»] chr2 (1 HSPs)
chr2 (1-254)||(38569338-38569598)


Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 38569338 - 38569598
Alignment:
1 ttaagaaaccggctcatatgaaattacatgcctttagtgatgcagattggggagactacttagatgatt-cagtg------tcgtggaggtaatttattt 93  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||  || |       |   |   |||||||||||    
38569338 ttaagaaaccggctcatatgaaattacatgcctttagtgatgcaaattggggagactacttagatgatcacacttctaccttaacgtttgtaatttattt 38569437  T
94 tggaggtaattcagtgttgtggctatccaagagacagagaactgtggcacgatcatcaccggaagctgaatatcgttcagtagcaaatgctacagtagag 193  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||    
38569438 tggaggtaattcagtgtcgtggctatccaagagacagagaactgtggcacgatcatcaccggaagctgaatatcattcagtagcaaatgctgcagcagag 38569537  T
194 gtcatgtggttgacaaaccttctcagtggattacatgtcaaaacaccagctcctcatctgt 254  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38569538 gtcatgtggttgacaaaccttctcagtggattacatgtcaaaacaccagctcctcatctgt 38569598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University