View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11379_high_74 (Length: 249)
Name: NF11379_high_74
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11379_high_74 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 52290078 - 52290316
Alignment:
| Q |
1 |
tctatttgcgctagttaaatctctattctcctttttatcactaaaatttgagatagccttaactttactgtccatagtactagacgaatggaccttctcg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52290078 |
tctatttgcgctagttaaatctttattctcctttttatcactaaaatttgagatagccttaactttactgtccatagtactagacgaatggaccttctcg |
52290177 |
T |
 |
| Q |
101 |
tcttccgagaatcttgctaagcaagaaatcaacgattcactttcctcttcattgattttatcaattagaaactcacttcttcttgaaggaacgtcggatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52290178 |
tcttccgagaatcttgctaagcaagaaatcaacgattcactttcctcttcattgattttatcaattagaaactcacttcttcttgaaggaacgtcggatg |
52290277 |
T |
 |
| Q |
201 |
tacttttccggcctttggatttcactttcttgacctttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52290278 |
tacttttccggcctttggatttcactttcttgacctttg |
52290316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University