View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11379_high_79 (Length: 241)

Name: NF11379_high_79
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11379_high_79
NF11379_high_79
[»] chr2 (1 HSPs)
chr2 (1-219)||(38569111-38569329)


Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 38569329 - 38569111
Alignment:
1 ccataattgaaggggagtttgagatattgaatgactcgtttaagttgccgaaaatggatctgtgtgggctggtgcatgaattgtgacagtttattgatgg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||    
38569329 ccataattgaaggggagtttgagatattgaatgactcgtttaagttgctgaaaagggatctgtgtgggctggtgcatgaattgtgacagtttattgatgg 38569230  T
101 aaaatgagaggtctggacaagtcaaggtgttgtatcgcaaagttccaataatgttgcaaaacattttggaatcagcttgtgtagatccgaccactagttg 200  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
38569229 aaaatgagaggtctggacgagtcaaggtgttgtatcgcaaagttccaataatgttgcgaaacattttggaatcagcttgtgtagatccgaccactagttg 38569130  T
201 aggggggatggaattgcaa 219  Q
    |||||||||||||||||||    
38569129 aggggggatggaattgcaa 38569111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University