View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11379_high_79 (Length: 241)
Name: NF11379_high_79
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11379_high_79 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 38569329 - 38569111
Alignment:
| Q |
1 |
ccataattgaaggggagtttgagatattgaatgactcgtttaagttgccgaaaatggatctgtgtgggctggtgcatgaattgtgacagtttattgatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38569329 |
ccataattgaaggggagtttgagatattgaatgactcgtttaagttgctgaaaagggatctgtgtgggctggtgcatgaattgtgacagtttattgatgg |
38569230 |
T |
 |
| Q |
101 |
aaaatgagaggtctggacaagtcaaggtgttgtatcgcaaagttccaataatgttgcaaaacattttggaatcagcttgtgtagatccgaccactagttg |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38569229 |
aaaatgagaggtctggacgagtcaaggtgttgtatcgcaaagttccaataatgttgcgaaacattttggaatcagcttgtgtagatccgaccactagttg |
38569130 |
T |
 |
| Q |
201 |
aggggggatggaattgcaa |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38569129 |
aggggggatggaattgcaa |
38569111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University