View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11379_high_81 (Length: 240)

Name: NF11379_high_81
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11379_high_81
NF11379_high_81
[»] chr3 (1 HSPs)
chr3 (17-240)||(41711887-41712106)


Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 41711887 - 41712106
Alignment:
17 aatttaatctacctttatgatgattgatatatagtatttagtaaatctagtaatataaggttgtttggctgatagccgcatgggttggggaatgagtata 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||  |    |||||||||||||||||||||||||||||    
41711887 aatttaatctacctttatgatgattgatatatagtatttagtaaatctagttatataaggttgtgag----atagccgcatgggttggggaatgagtata 41711982  T
117 aaaaaccagggttgtgacaccatcttcagtaaatgtaaaattgagcttgagttgagcatatcgaaattgaatcaatcttcgatgaaggttggggttgaga 216  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41711983 aaaaaccagggttgtgacactatcttcagtaaatgtaaaattgagcttgagttgagcatatcgaaattgaatcaatcttcgatgaaggttggggttgaga 41712082  T
217 tggggaattcaaactgttattgat 240  Q
    ||||||||||||||||||||||||    
41712083 tggggaattcaaactgttattgat 41712106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University