View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11379_high_82 (Length: 230)
Name: NF11379_high_82
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11379_high_82 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 52167003 - 52166884
Alignment:
| Q |
1 |
taacagatgcttgtccagtttcgaaatcaccaatcccaatagagtctacactaccagatgatctcttcaaaacagatttgctaaccggagtttcaaccat |
100 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52167003 |
taacagatgcttgtccagtttccacgtcaccaaccccaatagagtctacactaccagatgatctcttcaaagcagatttgctaaccggagtttcaaccat |
52166904 |
T |
 |
| Q |
101 |
gtttgtgtcgttgtatgagt |
120 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
52166903 |
gtttgtgtcgctgtatgagt |
52166884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 158 - 220
Target Start/End: Complemental strand, 52166792 - 52166730
Alignment:
| Q |
158 |
gacaaaataccatcactctttttgggatccgaatcctctccagttttatctctcctgcctttg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
52166792 |
gacaaaataccatcactctttttgggatccggatcctcttcagttttatctctcctgcctttg |
52166730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 180 - 220
Target Start/End: Complemental strand, 41782863 - 41782823
Alignment:
| Q |
180 |
tgggatccgaatcctctccagttttatctctcctgcctttg |
220 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
41782863 |
tgggatccggatcctctcccgttttatctctcctgcctttg |
41782823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University