View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11379_low_29 (Length: 405)
Name: NF11379_low_29
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11379_low_29 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 16 - 405
Target Start/End: Original strand, 10928911 - 10929300
Alignment:
| Q |
16 |
ctatcctctcactatcatttttagttgttaattttaactgatcctcactaggnnnnnnnncttttacaaatgaactacagaacggtgctacgacggattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
10928911 |
ctatcctctcactatcatttttagttgttaattttaactgatcctcactaggttttttttcttttacaaatgaactacagaatgttgctacgacggattt |
10929010 |
T |
 |
| Q |
116 |
tgaagtaaggcttggagcatggtcatgggataatgcaactggcgaagaacttcgtgtgggtgctggactgggagaaccatatggcatcacctggtgtgca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10929011 |
tgaagtaaggcttggagcatggtcatgggataatgcaactggcgaagaacttcgtgtgggtgctggactgggagaaccatatggcatcacctggtgtgca |
10929110 |
T |
 |
| Q |
216 |
gttgagtattttgaaaaaagtggtgctatattacgcttgctcctgcaatatgtctcaaatagttgtcactgtggaagaactattctacaccatgctatcc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10929111 |
gttgagtattttgaaaaaagtggtgctatattacgcttgctcctgcaacatgtctcaaataattgtcactgtggaagaactattctacaccatgctatcc |
10929210 |
T |
 |
| Q |
316 |
tttgtggcaatgtcgaggctgttaggatactcttagaatgtggtgctaatgtggaatccttagtcaaaacaaccagcaagaccgagttcc |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10929211 |
tttgtggcaatgtcgaggctgttaggatactcttagaatgtggtgctaatgtggaatccttagtcaaaacaaccagcaagaccgagttcc |
10929300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University