View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11379_low_55 (Length: 334)
Name: NF11379_low_55
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11379_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 308; Significance: 1e-173; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 52290004 - 52289689
Alignment:
| Q |
1 |
aaacgaaggttatgtcaagtagaatggaagagaatcgaagaggaaccgaaacgaaggttatgtcatgtagaatggaggagaaggtaaaagaaagctttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52290004 |
aaacgaaggttatgtcaagtagaatggaagagaatcgaagaggaaccgaaacgaaggttatgtcaagtagaatggaggagaaggtaaaagaaagctttgc |
52289905 |
T |
 |
| Q |
101 |
tttggtgaaaaagtcaaaggatccttacgaagacttcaagaaatcaatgttagagatgatagaagagatggaaatgtccgaagccaaggacttggagcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52289904 |
tttggtgaaaaagtcaaaggatccttacgaagacttcaagaaatcaatgttagagatgatagaagagatggaaatgtctgaagccaaggacttggagcaa |
52289805 |
T |
 |
| Q |
201 |
ctattgcagtgttttttggctctgaattctagagattatcatggagtaattgtgcgagctttcatggagatttggcaacaaatgttcgtttggaatccta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52289804 |
ctattgcagtgttttttggctctgaattctagagattatcatggagtaattgtgcgagctttcatggagatttggcaacaaatgttcgtttggaatccta |
52289705 |
T |
 |
| Q |
301 |
agtcgattacaaatct |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
52289704 |
agtcgattacaaatct |
52289689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 29 - 82
Target Start/End: Complemental strand, 52290024 - 52289971
Alignment:
| Q |
29 |
agagaatcgaagaggaaccgaaacgaaggttatgtcatgtagaatggaggagaa |
82 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
52290024 |
agagaatcaaagaggaaaagaaacgaaggttatgtcaagtagaatggaagagaa |
52289971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University