View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11379_low_69 (Length: 265)
Name: NF11379_low_69
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11379_low_69 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 38569338 - 38569598
Alignment:
| Q |
1 |
ttaagaaaccggctcatatgaaattacatgcctttagtgatgcagattggggagactacttagatgatt-cagtg------tcgtggaggtaatttattt |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || | | | ||||||||||| |
|
|
| T |
38569338 |
ttaagaaaccggctcatatgaaattacatgcctttagtgatgcaaattggggagactacttagatgatcacacttctaccttaacgtttgtaatttattt |
38569437 |
T |
|
| Q |
94 |
tggaggtaattcagtgttgtggctatccaagagacagagaactgtggcacgatcatcaccggaagctgaatatcgttcagtagcaaatgctacagtagag |
193 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |||| |
|
|
| T |
38569438 |
tggaggtaattcagtgtcgtggctatccaagagacagagaactgtggcacgatcatcaccggaagctgaatatcattcagtagcaaatgctgcagcagag |
38569537 |
T |
|
| Q |
194 |
gtcatgtggttgacaaaccttctcagtggattacatgtcaaaacaccagctcctcatctgt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38569538 |
gtcatgtggttgacaaaccttctcagtggattacatgtcaaaacaccagctcctcatctgt |
38569598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University