View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11379_low_70 (Length: 261)
Name: NF11379_low_70
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11379_low_70 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 14 - 252
Target Start/End: Complemental strand, 4788729 - 4788491
Alignment:
| Q |
14 |
atcaatccattcatcaacatcaccaccaaaggcatgctcactcccatcctcatcaccatcatcctctttcaccgcttcgactggagctttgcatccacac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4788729 |
atcaatccattcatcaacatcaccaccaaaggcatgctcactcccatcgtcatcaccatcatcctctttcaccgcttcgactggagctttgcatccacac |
4788630 |
T |
|
| Q |
114 |
caatggattttaaaatggcattatttagtcatatatgctatggaatccttttcaatttgtccatccctcgcatcatccattggatcaacccatcttccaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4788629 |
caatggattttaaaatggcattatttagtcatatatgctatggaatccttttcaatttgtccatccctcgcatcatccattggatcaacccatcttccaa |
4788530 |
T |
|
| Q |
214 |
tgtcaccaatgagttccttcttattcctattctctctgc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4788529 |
tgtcaccaatgagttccttcttattcctattctctctgc |
4788491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 4797294 - 4797331
Alignment:
| Q |
176 |
atccctcgcatcatccattggatcaacccatcttccaa |
213 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
4797294 |
atccctcacatcatccattggatcaatccatcttccaa |
4797331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 177 - 213
Target Start/End: Original strand, 4791759 - 4791795
Alignment:
| Q |
177 |
tccctcgcatcatccattggatcaacccatcttccaa |
213 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
4791759 |
tccctcacatcatccattggatcaatccatcttccaa |
4791795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University